Stem-loop sequence mdo-mir-7358

AccessionMI0023892 (change log)
DescriptionMonodelphis domestica miR-7358 stem-loop
Stem-loop
   -cg  a   u      u        gagc 
5'    cg aag uggcaa gccuccgg    c
      || ||| |||||| ||||||||     
3'    gc uuc accguu uggaggcu    u
   cag  c   c      -        gagg 
Get sequence
Deep sequencing
376 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001584678.1: 79123-79180 [-]
intergenic
Database links

Mature sequence mdo-miR-7358-5p

Accession MIMAT0028728
Sequence

1 - 

cgcgaaaguuggcaaugccucc

 - 22

Get sequence
Deep sequencing372 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7358-3p

Accession MIMAT0028729
Sequence

39 - 

agguuugccaccuuccggac

 - 58

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).