Stem-loop sequence mdo-mir-7357

AccessionMI0023891 (change log)
DescriptionMonodelphis domestica miR-7357 stem-loop
Stem-loop
   --         u     g   a  u   ac 
5'   gauggagug gccag cug gc gcc  u
     ||||||||| ||||| ||| || |||   
3'   uugucucac cgguc gac cg ugg  c
   cc         c     g   c  -   gg 
Get sequence
Deep sequencing
144 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001583204.1: 486143-486201 [-]
intergenic
Database links

Mature sequence mdo-miR-7357-5p

Accession MIMAT0028726
Sequence

1 - 

gauggagugugccaggcugagc

 - 22

Get sequence
Deep sequencing124 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7357-3p

Accession MIMAT0028727
Sequence

38 - 

ccaggcuggcccacucuguucc

 - 59

Get sequence
Deep sequencing20 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).