Stem-loop sequence mdo-mir-7356

AccessionMI0023890 (change log)
DescriptionMonodelphis domestica miR-7356 stem-loop
Stem-loop
   --- u   u  a  caa     u  a  cua 
5'    g ccc gc gc   gaccc gc gc   u
      | ||| || ||   ||||| || ||    
3'    c ggg cg cg   cuggg cg cg   c
   uuc u   c  a  cuc     c  a  uuu 
Get sequence
Deep sequencing
527 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 432130346-432130406 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7356
mdo-mir-7356bchr1: 432130349-432130408 [+]
mdo-mir-7356chr1: 432130346-432130406 [-]
mdo-mir-12305chr1: 432129485-432129549 [-]
Database links

Mature sequence mdo-miR-7356-5p

Accession MIMAT0028724
Sequence

1 - 

gucccugcagccaagacccugc

 - 22

Get sequence
Deep sequencing490 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7356-3p

Accession MIMAT0028725
Sequence

39 - 

cggguccucgcagccggguccuu

 - 61

Get sequence
Deep sequencing37 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).