Stem-loop sequence mdo-mir-7355

AccessionMI0023889 (change log)
DescriptionMonodelphis domestica miR-7355 stem-loop
Stem-loop
   --u         uaa a     ga  ucuucc 
5'    aggggaaag   g ugaag  gu      a
      |||||||||   | |||||  ||       
3'    uccccuuuc   c acuuc  cg      g
   acc         uca -     uc  uaacuu 
Get sequence
Deep sequencing
181 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001585921.1: 32063-32125 [+]
intergenic
Database links

Mature sequence mdo-miR-7355-5p

Accession MIMAT0028722
Sequence

1 - 

uaggggaaaguaagaugaagga

 - 22

Get sequence
Deep sequencing179 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7355-3p

Accession MIMAT0028723
Sequence

43 - 

cuucacacucuuuccccucca

 - 63

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).