Stem-loop sequence mdo-mir-7354

AccessionMI0023888 (change log)
DescriptionMonodelphis domestica miR-7354 stem-loop
Stem-loop
   --g     a    g    c c     uugcca 
5'    gagga guuu ccuc c ccacc      u
      ||||| |||| |||| | |||||       
3'    uuccu caaa gggg g ggugg      g
   cga     -    a    a a     uuuucc 
Get sequence
Deep sequencing
285 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 310418221-310418283 [-]
sense
ENSMODT00000018044 ; THSD7A-201; intron 15
Database links

Mature sequence mdo-miR-7354-5p

Accession MIMAT0028720
Sequence

1 - 

ggaggaaguuugccuccccccacc

 - 24

Get sequence
Deep sequencing35 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7354-3p

Accession MIMAT0028721
Sequence

41 - 

uggagaggggaaaacuccuuagc

 - 63

Get sequence
Deep sequencing244 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).