Stem-loop sequence mdo-mir-7353

AccessionMI0023887 (change log)
DescriptionMonodelphis domestica miR-7353 stem-loop
Stem-loop
   --     c  a      uucc      ug 
5'   auggu ug gucuga    uguggg  a
     ||||| || ||||||    ||||||  a
3'   uacca au cggacu    acaccu  a
   ac     a  c      ----      gu 
Get sequence
Deep sequencing
964 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 272052235-272052289 [-]
intergenic
Database links

Mature sequence mdo-miR-7353-5p

Accession MIMAT0028718
Sequence

1 - 

auggucugagucugauuccugugg

 - 24

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7353-3p

Accession MIMAT0028719
Sequence

36 - 

acaucaggccuaaaccauca

 - 55

Get sequence
Deep sequencing959 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).