Stem-loop sequence mdo-mir-7352

AccessionMI0023886 (change log)
DescriptionMonodelphis domestica miR-7352 stem-loop
Stem-loop
   --a   u     au         gg  aac 
5'    uag auccu  ggaaaaaug  cu   u
      ||| |||||  |||||||||  ||    
3'    auc uagga  ccuuuuuac  ga   u
   cga   u     gu         aa  guu 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 224465355-224465414 [-]
sense
ENSMODT00000006626 ; PTPRN2-201; intron 11
Database links

Mature sequence mdo-miR-7352-5p

Accession MIMAT0028716
Sequence

1 - 

auaguauccuauggaaaaaug

 - 21

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7352-3p

Accession MIMAT0028717
Sequence

40 - 

uuuuuccugaggauucuaagc

 - 60

Get sequence
Deep sequencing20 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).