Stem-loop sequence mdo-mir-7351

AccessionMI0023885 (change log)
DescriptionMonodelphis domestica miR-7351 stem-loop
Stem-loop
   --       caac           gggg 
5'   agaaagg    cuuucuuccuu    g
     |||||||    |||||||||||     
3'   ucuuucc    gaaagaaggaa    u
   cc       auca           agag 
Get sequence
Deep sequencing
210 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 192727717-192727772 [-]
intergenic
Database links

Mature sequence mdo-miR-7351-5p

Accession MIMAT0028714
Sequence

1 - 

agaaaggcaaccuuucuuccuu

 - 22

Get sequence
Deep sequencing59 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7351-3p

Accession MIMAT0028715
Sequence

35 - 

ggaagaaagacuaccuuucucc

 - 56

Get sequence
Deep sequencing149 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).