Stem-loop sequence mdo-mir-7350

AccessionMI0023884 (change log)
DescriptionMonodelphis domestica miR-7350 stem-loop
Stem-loop
   ---au       uu    cuc     uua 
5'      ucagaca  gggc   aacau   a
        |||||||  ||||   |||||    
3'      agucugu  uucg   uugua   a
   gauau       cu    uuu     cga 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 181585325-181585381 [-]
sense
ENSMODT00000019553 ; NDUFA5-201; intron 3
Database links

Mature sequence mdo-miR-7350-5p

Accession MIMAT0028712
Sequence

1 - 

auucagacauugggccucaaca

 - 22

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7350-3p

Accession MIMAT0028713
Sequence

35 - 

uuuuugcuuucugucugauauag

 - 57

Get sequence
Deep sequencing39 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).