Stem-loop sequence mdo-mir-7349

AccessionMI0023883 (change log)
DescriptionMonodelphis domestica miR-7349 stem-loop
Stem-loop
   --  c          cau        cac 
5'   ug uggauugagu   auacuugg   a
     || ||||||||||   ||||||||   g
3'   ac accugacuua   uaugaacu   u
   cg  a          auu        auu 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 420501859-420501917 [-]
intergenic
Database links

Mature sequence mdo-miR-7349-5p

Accession MIMAT0028710
Sequence

1 - 

ugcuggauugagucauauacuu

 - 22

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7349-3p

Accession MIMAT0028711
Sequence

38 - 

guauuuaauucaguccaacagc

 - 59

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).