Stem-loop sequence mdo-mir-7348

AccessionMI0023882 (change log)
DescriptionMonodelphis domestica miR-7348 stem-loop
Stem-loop
   ------------------------------------- u       u 
5'                                      c cugccuc c
                                        | ||||||| u
3'                                      g gacggag a
   aggaggcugagaucucggucccaauuaaauuauuagu u       a 
Get sequence
Deep sequencing
1868 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 290224917-290224976 [+]
sense
ENSMODT00000033993 ; RBMS3-201; intron 7
Database links

Mature sequence mdo-miR-7348-5p

Accession MIMAT0028708
Sequence

1 - 

cucugccucucuaagaggcagugu

 - 24

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7348-3p

Accession MIMAT0028709
Sequence

40 - 

ccuggcucuagagucggagga

 - 60

Get sequence
Deep sequencing1859 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).