Stem-loop sequence mdo-mir-7347

AccessionMI0023881 (change log)
DescriptionMonodelphis domestica miR-7347 stem-loop
Stem-loop
   --            g         -----     a 
5'   caagucaauuga ucaaaaugu     uguag a
     |||||||||||| |||||||||     ||||| c
3'   guucaguuaacu aguuuuaca     acguu a
   cg            -         aguuu     a 
Get sequence
Deep sequencing
114 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 262684272-262684336 [+]
sense
ENSMODT00000013329 ; C7orf63-201; intron 13
Database links

Mature sequence mdo-miR-7347-5p

Accession MIMAT0028706
Sequence

1 - 

caagucaauugagucaaaauguu

 - 23

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7347-3p

Accession MIMAT0028707
Sequence

44 - 

cauuuugaucaauugacuuggc

 - 65

Get sequence
Deep sequencing111 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).