Stem-loop sequence mdo-mir-7346

AccessionMI0023880 (change log)
DescriptionMonodelphis domestica miR-7346 stem-loop
Stem-loop
   -    -       a  au      gaaca  au 
5'  cggg gcgcagc ug  cggcgu     gc  u
    |||| ||||||| ||  ||||||     ||  c
3'  gccc cgcgucg gc  gccgcg     cg  a
   c    u       -  gg      ----a  ac 
Get sequence
Deep sequencing
192 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 109663248-109663309 [+]
sense
ENSMODT00000037180 ; PSD-201; intron 10
Database links

Mature sequence mdo-miR-7346-5p

Accession MIMAT0028704
Sequence

1 - 

cggggcgcagcaugaucggcgu

 - 22

Get sequence
Deep sequencing186 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7346-3p

Accession MIMAT0028705
Sequence

42 - 

gccgggcggcugcgcucccgc

 - 62

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).