Stem-loop sequence mdo-mir-7345-1

AccessionMI0023878 (change log)
DescriptionMonodelphis domestica miR-7345-1 stem-loop
Gene family MIPF0001767; mir-7345
Stem-loop
   --  c       -  u     cu    g  u 
5'   gu gcgaagg cg agcga  guca ug a
     || ||||||| || |||||  |||| ||  
3'   ca cguuucc gu ucgcu  cagu au u
   cc  c       u  -     --    g  a 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 35814648-35814705 [+]
sense
Database links

Mature sequence mdo-miR-7345-5p

Accession MIMAT0028702
Sequence

1 - 

gucgcgaaggcguagcgacuguca

 - 24

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7345-3p

Accession MIMAT0028703
Sequence

37 - 

acucgcuuguccuuugccaccc

 - 58

Get sequence
Deep sequencing144 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).