Stem-loop sequence mdo-mir-7344

AccessionMI0023876 (change log)
DescriptionMonodelphis domestica miR-7344 stem-loop
Stem-loop
   --        uc   u         ccc  g 
5'   uagucucu  ccu gaguguagu   ug a
     ||||||||  ||| |||||||||   || a
3'   aucggggg  gga cucauauca   ac u
   ua        uu   -         -ua  u 
Get sequence
Deep sequencing
40743 reads, 600 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 249561238-249561298 [-]
intergenic
Database links

Mature sequence mdo-miR-7344-5p

Accession MIMAT0028698
Sequence

1 - 

uagucucuucccuugaguguag

 - 22

Get sequence
Deep sequencing39617 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7344-3p

Accession MIMAT0028699
Sequence

41 - 

auacucagguugggggcuaau

 - 61

Get sequence
Deep sequencing1125 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).