Stem-loop sequence mdo-mir-16-2

AccessionMI0023875 (change log)
DescriptionMonodelphis domestica miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --u         ua        c  -agu  aa 
5'    agcagcacg  aauauugg gu    ga  u
      |||||||||  |||||||| ||    ||   
3'    ucgucgugu  uuauaacc ca    cu  c
   auu         ca        c  aagu  ga 
Get sequence
Deep sequencing
25548 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 242919053-242919117 [-]
sense
ENSMODT00000029432 ; mdo-mir-16-2-201; exon 1
antisense
Database links

Mature sequence mdo-miR-16-5p

Accession MIMAT0004145
Sequence

1 - 

uagcagcacguaaauauuggcg

 - 22

Get sequence
Deep sequencing50391 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-16-2-3p

Accession MIMAT0031103
Sequence

44 - 

ccaauauuacugugcugcuuua

 - 65

Get sequence
Deep sequencing333 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).