Stem-loop sequence mdo-mir-7343

AccessionMI0023874 (change log)
DescriptionMonodelphis domestica miR-7343 stem-loop
Stem-loop
   --        c c   c   a  g     acca 
5'   ucauggaa c gga gug gc augua    c
     |||||||| | ||| ||| || |||||    c
3'   ggugucuu g ccu cac cg ugcau    a
   cc        u a   u   c  a     guau 
Get sequence
Deep sequencing
36510 reads, 500 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 123247881-123247947 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7343
mdo-mir-12385chr7: 123249086-123249144 [-]
mdo-mir-7343chr7: 123247881-123247947 [-]
Database links

Mature sequence mdo-miR-7343-5p

Accession MIMAT0028696
Sequence

1 - 

ucauggaacccggacgugagc

 - 21

Get sequence
Deep sequencing35833 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7343-3p

Accession MIMAT0028697
Sequence

47 - 

ccacuuccaguuucuguggcc

 - 67

Get sequence
Deep sequencing676 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).