Stem-loop sequence mdo-mir-7342

AccessionMI0023873 (change log)
DescriptionMonodelphis domestica miR-7342 stem-loop
Stem-loop
   --        uc c      u  -agug u 
5'   ccugccuc  c cuugug gg     c u
     ||||||||  | |||||| ||     |  
3'   ggacggag  g gaacac cc     g a
   uu        ga u      u  guaaa a 
Get sequence
Deep sequencing
183 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 105264556-105264614 [-]
intergenic
Database links

Mature sequence mdo-miR-7342-5p

Accession MIMAT0028694
Sequence

1 - 

ccugccucuccccuugugugg

 - 21

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7342-3p

Accession MIMAT0028695
Sequence

39 - 

ucacaagugaggaggcagguu

 - 59

Get sequence
Deep sequencing178 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).