Stem-loop sequence mdo-mir-7341

AccessionMI0023872 (change log)
DescriptionMonodelphis domestica miR-7341 stem-loop
Stem-loop
   --      a  c       c      ugcuu 
5'   cccaaa gu ucagugc auuuua     u
     |||||| || ||||||| ||||||     a
3'   ggguuu ca agucacg uaaaau     a
   cg      -  c       -      uuaau 
Get sequence
Deep sequencing
13977 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 78195705-78195765 [-]
intergenic
Database links

Mature sequence mdo-miR-7341-5p

Accession MIMAT0028692
Sequence

1 - 

cccaaaagucucagugccauuuua

 - 24

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7341-3p

Accession MIMAT0028693
Sequence

40 - 

aaaugcacugacacuuuggggc

 - 61

Get sequence
Deep sequencing13977 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).