Stem-loop sequence mdo-mir-1805

AccessionMI0023871 (change log)
DescriptionMonodelphis domestica miR-1805 stem-loop
Gene family MIPF0000947; mir-1805
Stem-loop
   --        cc      -    agcucugc 
5'   aguuguag  uuucaa acag        a
     ||||||||  |||||| ||||         
3'   ucgacauc  aagguu uguc        u
   cc        ac      a    cacacaug 
Get sequence
Deep sequencing
3051 reads, 25 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 55378378-55378438 [-]
sense
ENSMODT00000040974 ; mdo-mir-1805-201; exon 1
ENSMODT00000000976 ; GABRG3-201; intron 2
Database links

Mature sequence mdo-miR-1805-5p

Accession MIMAT0028690
Sequence

1 - 

aguuguagccuuucaaacaga

 - 21

Get sequence
Deep sequencing36 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-1805-3p

Accession MIMAT0028691
Sequence

40 - 

uguauuggaacacuacagcucc

 - 61

Get sequence
Deep sequencing3015 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).