Stem-loop sequence mdo-mir-7340

AccessionMI0023870 (change log)
DescriptionMonodelphis domestica miR-7340 stem-loop
Stem-loop
   --           u         ----au   a 
5'   cuucagaacuu cuuauggac      cca a
     ||||||||||| |||||||||      ||| u
3'   gaagucuugaa gaauaccug      ggu c
   ug           -         ggaacu   u 
Get sequence
Deep sequencing
203 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 195304432-195304493 [+]
sense
ENSMODT00000027129 ; FNDC3B-201; intron 24
Database links

Mature sequence mdo-miR-7340-5p

Accession MIMAT0028688
Sequence

1 - 

cuucagaacuuucuuauggaca

 - 22

Get sequence
Deep sequencing154 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7340-3p

Accession MIMAT0028689
Sequence

42 - 

uccauaagaaguucugaaggu

 - 62

Get sequence
Deep sequencing49 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).