Stem-loop sequence mdo-mir-7339

AccessionMI0023869 (change log)
DescriptionMonodelphis domestica miR-7339 stem-loop
Stem-loop
   --      c         c   g   --ag  auc 
5'   aguuca aucuuucuc aca ccu    ag   u
     |||||| ||||||||| ||| |||    ||    
3'   uuaagu uagaagggg ugu gga    uc   a
   ag      a         a   -   gacg  ccu 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 184855502-184855568 [+]
sense
ENSMODT00000020097 ; mdo-mir-7339-201; 3'UTR (exon 14)
Database links

Mature sequence mdo-miR-7339-5p

Accession MIMAT0028686
Sequence

1 - 

aguucacaucuuucuccacagc

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7339-3p

Accession MIMAT0028687
Sequence

46 - 

uguaggggaagauaugaauuga

 - 67

Get sequence
Deep sequencing19 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).