Stem-loop sequence mdo-mir-7338

AccessionMI0023868 (change log)
DescriptionMonodelphis domestica miR-7338 stem-loop
Stem-loop
   --   uuca      -       c   augacaa 
5'   agu    gggcag cuagcua agu       u
     |||    |||||| ||||||| |||        
3'   ucg    ccuguu ggucgau uca       u
   ag   -uga      u       u   aaauuaa 
Get sequence
Deep sequencing
133 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 94990355-94990420 [+]
sense
ENSMODT00000007952 ; FGF14-201; intron 1
Database links

Mature sequence mdo-miR-7338-5p

Accession MIMAT0028684
Sequence

1 - 

aguuucagggcagcuagcuacag

 - 23

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7338-3p

Accession MIMAT0028685
Sequence

44 - 

uuagcugguuuguccagugcuga

 - 66

Get sequence
Deep sequencing115 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).