Stem-loop sequence mdo-mir-7337

AccessionMI0023867 (change log)
DescriptionMonodelphis domestica miR-7337 stem-loop
Stem-loop
   --   c   ac     c    cu   uu 
5'   aag cuc  ugaua cuau  ggu  a
     ||| |||  ||||| ||||  |||  c
3'   uuc gag  acuau gaua  uca  u
   gg   a   gc     u    cu   ua 
Get sequence
Deep sequencing
20213 reads, 240 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 87022416-87022472 [+]
intergenic
Database links

Mature sequence mdo-miR-7337-5p

Accession MIMAT0028682
Sequence

1 - 

aagccucacugauaccuauc

 - 20

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7337-3p

Accession MIMAT0028683
Sequence

38 - 

uaguuaucacggagacuugg

 - 57

Get sequence
Deep sequencing20205 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).