Stem-loop sequence mdo-mir-7336

AccessionMI0023866 (change log)
DescriptionMonodelphis domestica miR-7336 stem-loop
Stem-loop
   --  u    g  -a        a  cug u 
5'   ug ggau ca  agugugcg ug   c a
     || |||| ||  |||||||| ||   | u
3'   ac ccua gu  ucacacgc gc   g a
   ag  u    a  ca        c  aaa u 
Get sequence
Deep sequencing
1623 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 86952927-86952986 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7336
mdo-mir-7335chr7: 86952749-86952835 [+]
mdo-mir-7336chr7: 86952927-86952986 [+]
Database links

Mature sequence mdo-miR-7336-5p

Accession MIMAT0028680
Sequence

1 - 

uguggaugcaaagugugcgaug

 - 22

Get sequence
Deep sequencing442 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7336-3p

Accession MIMAT0028681
Sequence

38 - 

ccgcacacuacugaauccucaga

 - 60

Get sequence
Deep sequencing1180 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).