Stem-loop sequence mdo-mir-7335

AccessionMI0023865 (change log)
DescriptionMonodelphis domestica miR-7335 stem-loop
Stem-loop
   --      g  uc        ga     agagag        u  g 
5'   agcugu ga  ggcaucag  cagcu      gguuuaag ug u
     |||||| ||  ||||||||  |||||      |||||||| || u
3'   ucgaca uu  ccguaguc  gucga      ccggguuc au c
   ac      g  ua        ug     ------        u  a 
Get sequence
Deep sequencing
174 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 86952749-86952835 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7335
mdo-mir-7335chr7: 86952749-86952835 [+]
mdo-mir-7336chr7: 86952927-86952986 [+]
Database links

Mature sequence mdo-miR-7335-5p

Accession MIMAT0028678
Sequence

1 - 

agcuguggaucggcaucaggac

 - 22

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7335-3p

Accession MIMAT0028679
Sequence

66 - 

ucugaugccauuugacagcuca

 - 87

Get sequence
Deep sequencing164 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).