Stem-loop sequence mdo-mir-7334

AccessionMI0023864 (change log)
DescriptionMonodelphis domestica miR-7334 stem-loop
Stem-loop
   --     gugau   uu       c      -  ag 
5'   uggcu     gaa  uguguca aggguc ag  a
     |||||     |||  ||||||| |||||| ||   
3'   accga     cuu  acacagu uccuag uc  a
   uu     ---gu   uc       -      g  gg 
Get sequence
Deep sequencing
3107 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 257291026-257291092 [-]
sense
ENSMODT00000011130 ; PHF2-201; intron 1
Database links

Mature sequence mdo-miR-7334-5p

Accession MIMAT0028676
Sequence

1 - 

uggcugugaugaauuugugucacaggg

 - 27

Get sequence
Deep sequencing623 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7334-3p

Accession MIMAT0028677
Sequence

45 - 

cuugacacacuuucugagccauu

 - 67

Get sequence
Deep sequencing2484 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).