Stem-loop sequence mdo-mir-7333

AccessionMI0023863 (change log)
DescriptionMonodelphis domestica miR-7333 stem-loop
Stem-loop
   --           u        c uuuu 
5'   auuauauucag caacagac c    a
     ||||||||||| |||||||| |     
3'   ugauauaaguc guugucug g    u
   ac           c        a uaca 
Get sequence
Deep sequencing
56202 reads, 740 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 214453342-214453397 [-]
sense
ENSMODT00000003612 ; CADPS-201; intron 3
Clustered miRNAs
< 10kb from mdo-mir-7333
mdo-mir-7333chr6: 214453342-214453397 [-]
mdo-mir-12381chr6: 214449772-214449829 [-]
Database links

Mature sequence mdo-miR-7333-5p

Accession MIMAT0028674
Sequence

1 - 

auuauauucagucaacagacc

 - 21

Get sequence
Deep sequencing88 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7333-3p

Accession MIMAT0028675
Sequence

36 - 

ucuguugccugaauauaguca

 - 56

Get sequence
Deep sequencing56114 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).