Stem-loop sequence mdo-mir-7332

AccessionMI0023862 (change log)
DescriptionMonodelphis domestica miR-7332 stem-loop
Stem-loop
   --      c u  a        au --a   aa 
5'   caauag c gg ugauucag  g   aag  u
     |||||| | || ||||||||  |   |||   
3'   guuguc g uc acuaaguc  c   uuc  c
   ug      a -  a        cu cgg   ac 
Get sequence
Deep sequencing
73014 reads, 880 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 214337424-214337486 [-]
sense
ENSMODT00000003612 ; CADPS-201; intron 6
Database links

Mature sequence mdo-miR-7332-5p

Accession MIMAT0028672
Sequence

1 - 

caauagccuggaugauucagaug

 - 23

Get sequence
Deep sequencing52 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7332-3p

Accession MIMAT0028673
Sequence

42 - 

ccugaaucaacugacuguuggu

 - 63

Get sequence
Deep sequencing72962 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).