Stem-loop sequence mdo-mir-2970

AccessionMI0023861 (change log)
DescriptionMonodelphis domestica miR-2970 stem-loop
Gene family MIPF0001328; mir-2970
Stem-loop
   --g        u  u       - u  gag 
5'    acagucag ag uggucug g gu   c
      |||||||| || ||||||| | ||    
3'    ugucgguu uc acuagac c ua   a
   gag        c  c       u u  agg 
Get sequence
Deep sequencing
2828 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 201968080-201968138 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-2970
mdo-mir-191chr6: 201970817-201970890 [-]
mdo-mir-425chr6: 201968551-201968635 [-]
mdo-mir-2970chr6: 201968080-201968138 [-]
Database links

Mature sequence mdo-miR-2970-5p

Accession MIMAT0028670
Sequence

1 - 

gacagucaguaguuggucugg

 - 21

Get sequence
Deep sequencing2688 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-2970-3p

Accession MIMAT0028671
Sequence

39 - 

agaucaccucuuggcugugag

 - 59

Get sequence
Deep sequencing140 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).