Stem-loop sequence mdo-mir-218-2

AccessionMI0023860 (change log)
DescriptionMonodelphis domestica miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   --uu         cu        gg  gaacg 
5'     gugcuugau  aaccaugu  ug     a
       |||||||||  ||||||||  ||      
3'     cacgaacug  uugguaca  ac     u
   gcgc         uc        ag  aaaga 
Get sequence
Deep sequencing
9753 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 367287193-367287256 [-]
sense
ENSMODT00000028293 ; mdo-mir-218-2-201; exon 1
ENSMODT00000009061 ; SLIT3-201; intron 11
Database links

Mature sequence mdo-miR-218-5p

Accession MIMAT0004133
Sequence

1 - 

uugugcuugaucuaaccaugu

 - 21

Get sequence
Deep sequencing18828 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-218-2-3p

Accession MIMAT0031111
Sequence

44 - 

augguucugucaagcaccgcg

 - 64

Get sequence
Deep sequencing273 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).