Stem-loop sequence mdo-mir-7331-2

AccessionMI0023859 (change log)
DescriptionMonodelphis domestica miR-7331-2 stem-loop
Gene family MIPF0001736; mir-7331
Stem-loop
   -aac      ucu  a  ua     c  -  auca 
5'     cugacc   ga gc  cauag ag ug    a
       ||||||   || ||  ||||| || ||    a
3'     gacugg   cu cg  guauc uc ac    u
   ucuu      cau  -  --     c  u  aacg 
Get sequence
Deep sequencing
96716 reads, 1.42e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 86716344-86716411 [-]
sense
ENSMODT00000002361 ; GABBR2-201; intron 1
Database links

Mature sequence mdo-miR-7331-5p

Accession MIMAT0028668
Sequence

1 - 

aaccugaccucugaagcuacau

 - 22

Get sequence
Deep sequencing191172 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7331-2-3p

Accession MIMAT0031091
Sequence

51 - 

ggcucuacggucaguucu

 - 68

Get sequence
Deep sequencing1130 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).