Stem-loop sequence mdo-mir-7330

AccessionMI0023857 (change log)
DescriptionMonodelphis domestica miR-7330 stem-loop
Stem-loop
   --c   cu             c   ggcug 
5'    uug  cagagucacauag uag     c
      |||  ||||||||||||| |||      
3'    aac  guuucaguguauu auc     u
   cua   cg             c   auuaa 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 81519582-81519641 [-]
intergenic
Database links

Mature sequence mdo-miR-7330-5p

Accession MIMAT0028666
Sequence

1 - 

cuugcucagagucacauagcua

 - 22

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7330-3p

Accession MIMAT0028667
Sequence

39 - 

cuuaugugacuuuggccaaauc

 - 60

Get sequence
Deep sequencing72 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).