Stem-loop sequence mdo-mir-873

AccessionMI0023856 (change log)
DescriptionMonodelphis domestica miR-873 stem-loop
Gene family MIPF0000390; mir-873
Stem-loop
   --ug a      ug g       ua  ga 
5'     c ggaacu  u agucucc  uu  a
       | ||||||  | |||||||  ||  a
3'     g ccuuga  g ucagagg  aa  a
   aagg c      gu g       gc  gu 
Get sequence
Deep sequencing
2923 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 46253223-46253281 [-]
sense
ENSMODT00000040668 ; mdo-mir-873-201; exon 1
Database links

Mature sequence mdo-miR-873-5p

Accession MIMAT0028664
Sequence

1 - 

ugcaggaacuugugagucucc

 - 21

Get sequence
Deep sequencing2815 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-873-3p

Accession MIMAT0028665
Sequence

39 - 

agacuggugaguucccgggaa

 - 59

Get sequence
Deep sequencing108 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).