Stem-loop sequence mdo-mir-505

AccessionMI0023855 (change log)
DescriptionMonodelphis domestica miR-505 stem-loop
Stem-loop
   --        --c     a   c    cuauu 
5'   aggggaac   aggug uug gugc     g
     ||||||||   ||||| ||| ||||      
3'   ucucuuug   uucac aac uacg     a
   uc        uuc     -   -    acaga 
Get sequence
Deep sequencing
91 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 32562783-32562842 [-]
sense
ENSMODT00000004120 ; EPB41L4B-201; intron 15
Database links

Mature sequence mdo-miR-505-5p

Accession MIMAT0028662
Sequence

1 - 

aggggaaccaggugauugcgugc

 - 23

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-505-3p

Accession MIMAT0028663
Sequence

38 - 

aucaacacuucuuguuucucucu

 - 60

Get sequence
Deep sequencing75 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).