Stem-loop sequence mdo-mir-7329

AccessionMI0023854 (change log)
DescriptionMonodelphis domestica miR-7329 stem-loop
Stem-loop
   ---  u       c     u    cuuc     cc 
5'    gg gagcauu ucauu ggcc    ucguu  c
      || ||||||| ||||| ||||    |||||  u
3'    cc uucguaa gguaa ccgg    agcgg  c
   acu  -       c     -    ---a     aa 
Get sequence
Deep sequencing
20600 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 282778000-282778064 [+]
intergenic
Database links

Mature sequence mdo-miR-7329-5p

Accession MIMAT0028660
Sequence

1 - 

ggugagcauucucauuuggcccuu

 - 24

Get sequence
Deep sequencing237 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7329-3p

Accession MIMAT0028661
Sequence

43 - 

aggccaauggcaaugcuuccuca

 - 65

Get sequence
Deep sequencing20363 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).