Stem-loop sequence mdo-mir-7328

AccessionMI0023853 (change log)
DescriptionMonodelphis domestica miR-7328 stem-loop
Stem-loop
   --        gcua              g a  g 
5'   cuggcucg    cugguuuuuaaugu u ag u
     ||||||||    |||||||||||||| | ||  
3'   gaccgggc    gaucaagaauuacg a uc u
   uc        ---a              g a  g 
Get sequence
Deep sequencing
37351 reads, 440 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 280355988-280356052 [+]
sense
ENSMODT00000015803 ; ERC2-201; intron 13
Database links

Mature sequence mdo-miR-7328-5p

Accession MIMAT0028658
Sequence

1 - 

cuggcucggcuacugguuuuuaau

 - 24

Get sequence
Deep sequencing23 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7328-3p

Accession MIMAT0028659
Sequence

45 - 

uaagaacuagacgggccagcu

 - 65

Get sequence
Deep sequencing37328 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).