Stem-loop sequence mdo-mir-7327

AccessionMI0023852 (change log)
DescriptionMonodelphis domestica miR-7327 stem-loop
Stem-loop
   --          a   c       - uaucc 
5'   ggagggguug aga ucgcccc c     u
     |||||||||| ||| ||||||| |      
3'   ccuucccaac uuu agcgggg g     g
   ac          a   u       a ucuca 
Get sequence
Deep sequencing
763 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 243825029-243825089 [+]
sense
ENSMODT00000006989 ; ATP2B2-201; intron 12
Database links

Mature sequence mdo-miR-7327-5p

Accession MIMAT0028656
Sequence

1 - 

ggagggguugaagacucgcccc

 - 22

Get sequence
Deep sequencing70 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7327-3p

Accession MIMAT0028657
Sequence

40 - 

ggcgauuuuacaacccuuccca

 - 61

Get sequence
Deep sequencing690 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).