Stem-loop sequence mdo-mir-7326

AccessionMI0023851 (change log)
DescriptionMonodelphis domestica miR-7326 stem-loop
Stem-loop
   --uc      gc   -       u ug au 
5'     agagag  gau aguugag u  c  g
       ||||||  ||| ||||||| |  |   
3'     ucucuc  cua ucgacuc a  g  a
   ggga      ua   c       - gu ga 
Get sequence
Deep sequencing
143 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 223394491-223394548 [+]
sense
ENSMODT00000004692 ; MITF-201; intron 2
Database links

Mature sequence mdo-miR-7326-5p

Accession MIMAT0028654
Sequence

1 - 

ucagagaggcgauaguugaguuu

 - 23

Get sequence
Deep sequencing140 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7326-3p

Accession MIMAT0028655
Sequence

35 - 

acucagcucaucaucucucuaggg

 - 58

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).