Stem-loop sequence mdo-mir-193b

AccessionMI0023850 (change log)
DescriptionMonodelphis domestica miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   --    gu    a    g  a  ag uua 
5'   cggg  uuug gggc ag ug  u   u
     ||||  |||| |||| || ||  |   g
3'   gccc  aaac cccg uc ac  a   u
   uc    ug    a    g  a  cu uuu 
Get sequence
Deep sequencing
1663 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 108685053-108685111 [+]
sense
ENSMODT00000040377 ; mdo-mir-193b-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-193b
mdo-mir-193bchr6: 108685053-108685111 [+]
mdo-mir-365chr6: 108690913-108690999 [+]
Database links

Mature sequence mdo-miR-193b-5p

Accession MIMAT0028652
Sequence

1 - 

cgggguuuugagggcgagauga

 - 22

Get sequence
Deep sequencing324 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-193b-3p

Accession MIMAT0028653
Sequence

38 - 

aacuggcccacaaagucccgcu

 - 59

Get sequence
Deep sequencing1339 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).