Stem-loop sequence mdo-mir-7325

AccessionMI0023849 (change log)
DescriptionMonodelphis domestica miR-7325 stem-loop
Stem-loop
   -gag     g      u   g ug aaua 
5'     ggccc guuucc cug c  c    u
       ||||| |||||| ||| |  |     
3'     cuggg uaaagg gac g  g    u
   guua     g      u   - gu agac 
Get sequence
Deep sequencing
3658 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 223677437-223677494 [-]
sense
ENSMODT00000003558 ; PPP2R2C-201; intron 1
Database links

Mature sequence mdo-miR-7325-5p

Accession MIMAT0028650
Sequence

1 - 

gagggcccgguuuccucuggc

 - 21

Get sequence
Deep sequencing3657 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7325-3p

Accession MIMAT0028651
Sequence

39 - 

caguggaaauggggucauug

 - 58

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).