Stem-loop sequence mdo-mir-7324

AccessionMI0023848 (change log)
DescriptionMonodelphis domestica miR-7324 stem-loop
Stem-loop
   --    ac             cuu    aag 
5'   aaac  caguguauauucu   uuua   u
     ||||  |||||||||||||   ||||    
3'   uuug  gucgcguauaaga   aaau   u
   ga    cc             --u    acu 
Get sequence
Deep sequencing
5544 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 118791957-118792016 [-]
sense
ENSMODT00000002175 ; GLRB-201; intron 4
Database links

Mature sequence mdo-miR-7324-5p

Accession MIMAT0028648
Sequence

1 - 

aaacaccaguguauauucucuu

 - 22

Get sequence
Deep sequencing608 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7324-3p

Accession MIMAT0028649
Sequence

39 - 

uagaauaugcgcugccguuuag

 - 60

Get sequence
Deep sequencing4934 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).