Stem-loop sequence mdo-mir-7323

AccessionMI0023847 (change log)
DescriptionMonodelphis domestica miR-7323 stem-loop
Stem-loop
   --          -gu       g    gcuua 
5'   uuacagaauu   gugacag uugu     g
     ||||||||||   ||||||| ||||     u
3'   aaugucuugg   cacuguc gaca     g
   cc          guc       -    aaauu 
Get sequence
Deep sequencing
37092 reads, 420 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 110351157-110351219 [-]
antisense
ENSMODT00000002671 ; mdo-mir-7323-201; exon 2
Clustered miRNAs
< 10kb from mdo-mir-7323
mdo-mir-7323bchr5: 110351159-110351220 [+]
mdo-mir-7323chr5: 110351157-110351219 [-]
Database links

Mature sequence mdo-miR-7323-5p

Accession MIMAT0028646
Sequence

1 - 

uuacagaauugugugacaggu

 - 21

Get sequence
Deep sequencing30046 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7323-3p

Accession MIMAT0028647
Sequence

42 - 

cugucaccuggguucuguaacc

 - 63

Get sequence
Deep sequencing7043 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).