Stem-loop sequence mdo-mir-7322

AccessionMI0023846 (change log)
DescriptionMonodelphis domestica miR-7322 stem-loop
Stem-loop
   --   a       u       a     aau 
5'   gag aggaaug gaucgcu ccagu   u
     ||| ||||||| ||||||| |||||    
3'   cuc uccuuau cugguga gguua   u
   uu   a       -       -     aua 
Get sequence
Deep sequencing
13863 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 107450087-107450144 [-]
intergenic
Database links

Mature sequence mdo-miR-7322-5p

Accession MIMAT0028644
Sequence

1 - 

gagaaggaaugugaucgcuacc

 - 22

Get sequence
Deep sequencing13833 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7322-3p

Accession MIMAT0028645
Sequence

38 - 

gaguggucuauuccuacucuu

 - 58

Get sequence
Deep sequencing25 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).