Stem-loop sequence mdo-mir-7321

AccessionMI0023845 (change log)
DescriptionMonodelphis domestica miR-7321 stem-loop
Stem-loop
   --                     ---    a 
5'   ucugaauugaagcagcuuaca   uguu g
     |||||||||||||||||||||   ||||  
3'   ggacuuaacuucgucgaaugu   acaa c
   ag                     aag    u 
Get sequence
Deep sequencing
126 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 76923145-76923203 [-]
intergenic
Database links

Mature sequence mdo-miR-7321-5p

Accession MIMAT0028642
Sequence

1 - 

ucugaauugaagcagcuuaca

 - 21

Get sequence
Deep sequencing125 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7321-3p

Accession MIMAT0028643
Sequence

39 - 

uaagcugcuucaauucaggga

 - 59

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).