Stem-loop sequence mdo-mir-7320

AccessionMI0023844 (change log)
DescriptionMonodelphis domestica miR-7320 stem-loop
Stem-loop
   -ccca    a a   g       gaccu 
5'      accc c ggg ugcccug     u
        |||| | ||| |||||||      
3'      uggg g ccc acgggac     u
   aagag    c a   g       aaauu 
Get sequence
Deep sequencing
2088 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 282623683-282623739 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7320
mdo-mir-7320bchr5: 282623679-282623739 [-]
mdo-mir-7320chr5: 282623683-282623739 [+]
Database links

Mature sequence mdo-miR-7320-5p

Accession MIMAT0028640
Sequence

1 - 

cccaacccacaggggugcccug

 - 22

Get sequence
Deep sequencing2072 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7320-3p

Accession MIMAT0028641
Sequence

37 - 

gggcagcccagcgggugagaa

 - 57

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).