Stem-loop sequence mdo-mir-7319

AccessionMI0023843 (change log)
DescriptionMonodelphis domestica miR-7319 stem-loop
Stem-loop
   --c  c       g  uc  gu    u   cu 
5'    cc ucucugg cc  cu  uucc cau  g
      || ||||||| ||  ||  |||| |||  u
3'    gg agagauc gg  ga  aagg gua  a
   ugu  u       a  uu  --    -   aa 
Get sequence
Deep sequencing
338562 reads, 5.52e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 268329078-268329139 [+]
sense
ENSMODT00000012326 ; EIF3M-201; intron 1
Database links

Mature sequence mdo-miR-7319-5p

Accession MIMAT0028638
Sequence

1 - 

ccccucucugggccuccuguuucc

 - 24

Get sequence
Deep sequencing20 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7319-3p

Accession MIMAT0028639
Sequence

41 - 

aaaguuggacuagagauggugu

 - 62

Get sequence
Deep sequencing338416 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).