Stem-loop sequence mdo-mir-7318

AccessionMI0023842 (change log)
DescriptionMonodelphis domestica miR-7318 stem-loop
Stem-loop
   --                     --    u 
5'   ccucagauuucuauacgcauu  ugua u
     |||||||||||||||||||||  |||| c
3'   ggagucuaaagauaugcguaa  acau u
   cc                     gu    c 
Get sequence
Deep sequencing
4245636 reads, 7.33e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 18615368-18615426 [+]
sense
ENSMODT00000024247 ; RUFY3-201; intron 1
ENSMODT00000041810 ; RUFY3-202; intron 1
Database links

Mature sequence mdo-miR-7318-5p

Accession MIMAT0028636
Sequence

1 - 

ccucagauuucuauacgcauuu

 - 22

Get sequence
Deep sequencing1992 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7318-3p

Accession MIMAT0028637
Sequence

38 - 

augcguauagaaaucugaggcc

 - 59

Get sequence
Deep sequencing4243644 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).