Stem-loop sequence mdo-mir-7317

AccessionMI0023841 (change log)
DescriptionMonodelphis domestica miR-7317 stem-loop
Stem-loop
   --aa   -        u        -a  aa 
5'     cuc cgugguuc cugaaaga  gc  u
       ||| |||||||| ||||||||  ||  a
3'     ggg guacuagg gauuuucu  cg  g
   aaaa   a        u        aa  au 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 224613794-224613854 [+]
sense
ENSMODT00000042141 ; TADA2B-201; intron 2
antisense
ENSMODT00000017760 ; CCDC96-201; intron 2
Database links

Mature sequence mdo-miR-7317-5p

Accession MIMAT0028634
Sequence

1 - 

aacuccgugguucucugaaaga

 - 22

Get sequence
Deep sequencing36 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7317-3p

Accession MIMAT0028635
Sequence

39 - 

uuuuaguggaucaugagggaaaa

 - 61

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).