Stem-loop sequence mdo-mir-7316

AccessionMI0023840 (change log)
DescriptionMonodelphis domestica miR-7316 stem-loop
Stem-loop
   --aaa        cc         guau 
5'      gaugccag  caugcccag    u
        ||||||||  |||||||||    u
3'      cugcgguc  guacggguc    a
   uucuc        ca         aaac 
Get sequence
Deep sequencing
5828 reads, 75 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 17233176-17233232 [+]
intergenic
Database links

Mature sequence mdo-miR-7316-5p

Accession MIMAT0028632
Sequence

1 - 

aaagaugccagcccaugcccag

 - 22

Get sequence
Deep sequencing5826 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7316-3p

Accession MIMAT0028633
Sequence

36 - 

gggcaugaccuggcguccucuu

 - 57

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).